همسانه سازی و بیان آنتی‌ژن حفاظتی تغییر‌یافته باسیلوس‌آنتراسیس در باکتری E. coli

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشجوی دکتری نانوبیوتکنولوژی، مرکز و گروه علوم زیستی، دانشگاه جامع امام حسین(ع)، تهران.

2 دانشیار گروه علوم زیستی، دانشگاه جامع امام حسین(ع)، تهران.

چکیده

زمینه و هدف: سیاه­زخم یک بیماری مشترک بین انسان و دام است. عامل این بیماری باکتری باسیلوس آنتراسیس می­باشد. آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس برای درمان و واکسن قابل استفاده می باشد. هدف این مطالعه بیان آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس در باکتریE. coli می­باشد.
 مواد و روش ها:  قطعات ژنی مورد نظر از پلاسمید pXOI  تکثیر و  با عمل SOEiong PCR  قطعه بدست آمده در کلونینگ وکتور همسانه­سازی گردید و بعد از جداسازی به وکتور pET28a(+)  زیرهمسانه­سازی و به باکتری E.coli سویه BL21(DE3) تراریخت شد. بیان آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس تحت القایIPTG انجام و بعد از تخلیص پروتئین با استفاده از کروماتوگرافی تمایلی، آنتی­ژن حاصل در چهار نوبت به موش­های سوری تزریق شد. آنتی­بادی پلی­کلونال تولید شده در سرم موش­ها اندازه­گیری گردید.
یافته ها: آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس کلون شده در وکتور بیانی pET28a(+) به وسیله­ی PCR،  آنالیز آنزیمی  و توالی یابی تأیید گردید. پروتئین نوترکیب تولید شده به وسیله SDS-PAGE و لکه­گذاری وسترن تایید شد. سرم از خون موش جداسازی شد و تیتر آنتی بادی علیه PA تغییر یافته از طریق الایزای غیر مستقیم ارزیابی گردید.
نتیجه گیری: پروتئین تولیدی دارای خاصیت مهار کنندگی بالایی برای فاکتورهای بیماریزای LF و EF می باشد. با توجه به شناسایی آنتی ژن PA بوسیله آنتی بادی آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس، می­توان به­صورت مجزا، یا ترکیبی با سایر دومن های PA در طراحی واکسن و بعنوان دارو برای درمان و پیشگیری بیماری سیاه­زخم استفاده نمود.

کلیدواژه‌ها


عنوان مقاله [English]

Cloning and Recombinant Expression modified protective antigen from Bacillus anthracis In E. coil

نویسندگان [English]

  • Seyed Masih E'temad Aubi 1
  • Hossein Honari 2
چکیده [English]

Background: Anthrax is a common illness between human and animal which the agent of that is Bacillus anthracis. The modified protective antigen cab be used in treatment and vaccination. The aim of this study is the recombinant expression of modified protective antigen in E. coli.
Material and Methods: Gene fragments were amplified with PCR from pXOI and fusion gene from SOEing PCR was cloned in a cloning vector and finally sub cloned in pET28a(+) vector and transferred to E. coli BL21(DE3) competent cells. Recombinant expression of modified PA was induced by IPTG and after protein purification with affinity chromatography, resulted antigen was injected to mice in 4 repeats. Polyclonal antibodies produced in mice serum was accessed.
Results: The modified protective antigen cloned in expression vector pET28a(+) was confirmed by PCR, enzymatic digestion and sequencing. Recombinant protein was confirmed by SDS-PAGE and western blot. Serum was separated from mice blood and titre of antibody against modified PA was assessed by indirect ELYSA.
Conclusion: resulted protein has high inhibitory property for LF and EF virulence factors. By consideration in PA detection by polyclonal antibody against modified PA from Bacillus anthracis, it can be used in for treatment and prophylaxis against anthrax in individual or combination forms with other PA domains.

کلیدواژه‌ها [English]

  • protective antigen
  • Bacillus anthracis
  • recombinant protein

 

مقاله اصیل

 

 

 


همسانه سازی و بیان آنتی­ژن حفاظتی تغییر­یافته باسیلوس­آنتراسیس در باکتری E. coli

 

سید مسیح اعتماد ایوبی1، حسین هنری2

1 دانشجوی دکتری نانوبیوتکنولوژی، مرکز و گروه علوم زیستی، دانشگاه جامع امام حسین(ع)، تهران.

2 دانشیار گروه علوم زیستی، دانشگاه جامع امام حسین(ع)، تهران.

 

* نشانی نویسنده مسئول: تهران، دانشگاه امام حسین (ع)، گروه علوم زیستی، حسین هنری

E-mail: honari.hosein@gmail.com

 

وصول:12/8/94، اصلاح:2/10/94، پذیرش:11/11/94

چکیده

زمینه و هدف: سیاه­زخم یک بیماری مشترک بین انسان و دام است. عامل این بیماری باکتری باسیلوس آنتراسیس می­باشد. آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس برای درمان و واکسن قابل استفاده می باشد. هدف این مطالعه بیان آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس در باکتریE. coli می­باشد.

 مواد و روش ها:  قطعات ژنی مورد نظر از پلاسمید pXOI  تکثیر و  با عمل SOEiong PCR  قطعه بدست آمده در کلونینگ وکتور همسانه­سازی گردید و بعد از جداسازی به وکتور pET28a(+)  زیرهمسانه­سازی و به باکتری E.coli سویه BL21(DE3) تراریخت شد. بیان آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس تحت القایIPTG انجام و بعد از تخلیص پروتئین با استفاده از کروماتوگرافی تمایلی، آنتی­ژن حاصل در چهار نوبت به موش­های سوری تزریق شد. آنتی­بادی پلی­کلونال تولید شده در سرم موش­ها اندازه­گیری گردید.

یافته ها: آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس کلون شده در وکتور بیانی pET28a(+) به وسیله­ی PCR،  آنالیز آنزیمی  و توالی یابی تأیید گردید. پروتئین نوترکیب تولید شده به وسیله SDS-PAGE و لکه­گذاری وسترن تایید شد. سرم از خون موش جداسازی شد و تیتر آنتی بادی علیه PA تغییر یافته از طریق الایزای غیر مستقیم ارزیابی گردید.

نتیجه گیری: پروتئین تولیدی دارای خاصیت مهار کنندگی بالایی برای فاکتورهای بیماریزای LF و EF می باشد. با توجه به شناسایی آنتی ژن PA بوسیله آنتی بادی آنتی ژن حفاظتی تغییر یافته باسیلوس آنتراسیس، می­توان به­صورت مجزا، یا ترکیبی با سایر دومن های PA در طراحی واکسن و بعنوان دارو برای درمان و پیشگیری بیماری سیاه­زخم استفاده نمود.

کلید واژه: آنتی ژن حفاظتی تغییر یافته،  باسیلوس آنتراسیس، پروتئین نوترکیب.

 


مقدمه

سیاه­زخم (Anthrax) یک بیماری مشترک بین انسان و دام است که به ‌وسیله باکتری باسیلوس­آنتراسیس (Bacillus anthracis)ایجاد می­شود(2،1). باکتری باسیلوس­آنتراسیس یکی از بزرگ‌ترین و مهم‌ترین عوامل بیولوژیک به شمار می­رود و پتانسیل استفاده در جنگ­های بیولوژیک را دارا هست(1). باسیلوس­آنتراسیس علاوه بر یک DNA حلقوی به‌اندازه 5/4 مگاباز، دارای دو پلاسمید بزرگ pXO1 (شامل ژن­های توکسیک) و pXO2 (شامل ژن­های مولد کپسول) هست. توکسین با واسطه یک پلاسمید به نام PBA1 یا pXO1 ایجاد می­شود که 3 پروتئین یا فاکتور مولد ادم (EdemaFactor)(EF)، آنتی­ژن محافظت­کننده (PA) (protective antigen) و فاکتور مولد مرگ سلولی (LethalFactor)(LF) را کد می­کند (4،3). پروتئین ژن PA به‌طور اختصاصی به گیرنده‌های سطح سلول می‌چسبد. سپس PA توسط پروتئازهای شبیه به فورین شکسته می‌شود و دو قطعه PA20 و PA63 ایجاد می‌‌گردد که قطعه PA63 در سطح سلول باقی‌‌­مانده و برای اتصال LF و EF آ‎ماده­شده و تشکیل ساختار هپتامری، ایجاد منفذ و ترانسلوکاسیون به داخل سلول انجام می­گیرد(5). آنتی­ژن محافظت­کننده (PA) کامل و فاقد قطعه 20 کیلودالتونی (بعد از ورود آنتی­ژن محافظت­کننده (PA) کامل با طول 63 کیلودالتون به داخل بدن، یک قطعه 20 کیلودالتونی از آن جدا می­شود و قطعه­ای به طول 63 کیلودالتون باقی می­ماند) با یک و یا دو اسید­آمینه تغییر­یافته در نواحی 427 یا 396 و 425 دارای خاصیت مهار­کنندگی برای فاکتور­های بیماری‌زایLF و EF هست(6،3). امروزه سیستم‌های بیانی بسیار متنوعی وجود دارد و در اشل صنعتی از باکتری، مخمر، گیاه، سلول حیوانی استفاده می­شود. با توجه به کاربردی بودن این سیستم در آزمایشگاه­ها و کم‌هزینه بودن آن، در این پژوهش از سیستم بیانی باکتری استفاده‌شده است. در ادامه به ‌منظور تولید کاندید واکسن و داروی­ نوترکیب، آنتی­ژن محافظت­کننده (PA) 63 کیلو دالتونی با یک اسید­آمینه تغییر­یافته باسیلوس آنتراسیس (mPA) همسانه­سازی، بیان و تولید آنتی­بادی پلی­کلونال در موش سوری انجام شد تا در آینده نقش آن در طراحی واکسن یا دارو با سایر دومن‌هایLF، EF و  PAمورد مطالعه قرار گیرد.

 

مواد و روش‌ها

طراحی پرایمر برای آنتی‌ژن حفاظتی مربوط به باکتری باسیلوس آنتراسیس: توالی کامل ژن PA باکتری باسیلوس­آنتراسیس از بانک ژن (NBCI با شماره Accession No: M29081) استخراج و طراحی پرایمر­ها انجام و توسط شرکت سینا ژن سنتز شد.

توالی پرایمر رفت با جایگاه شناسایی آنزیم محدودالاثر BamHI (فرمنتاز):

For5' GAGGATCCACAAGTGCTGGACCTACGGT3'

For5' AATGCACAAGACGATGGCAGTTCTACTCCAATTACAATGA3' SOEing PCR

توالی پرایمر برگشت با جایگاه شناسایی آنزیم محدودالاثرXhoI (فرمنتاز):

Rev5'CTGGCATCGTCTTGTGCATTTAATGC3' SOEing PCR

Rev5'GGCTCGAGTTATCCTATCTCATAGCCTTTT3'

تکثیر قطعات ژن PA با واکنش PCR: باکتری باسیلوس­آنتراسیس از بخش هوازی موسسه رازی تهیه شد. پلاسمیدهای باکتری با استفاده از روش فنل-کلروفرم استخراج و به‌عنوان الگو در واکنش  PCRاستفاده شد. واکنش PCR برای تکثیر قطعات ژنPA ابتدا با آنزیم Taqپلی­مراز(سینا ژن) بهینه­سازی شد. به‌منظور جلوگیری از موتاسیون­های ناخواسته تکثیر نهایی ژن با استفاده از آنزیم Pfu پلی­مراز(فرمنتاز) صورت گرفت. با عمل SOEing PCR دو قطعه به یک قطعه تبدیل شد (7،3،1).

همسا­سازی و زیرهمسانه‌سازی) قطعه حاصل از (PCR به وکتورها: محصول PCRبه کمک مارکر اسید­نوکلئیک (#SM0313)(فرمنتاز) روی ژل آگارز(مرک) بررسی و سپس از روی ژل تخلیص و به انتهای آن­ها نوکلئوتید A اضافه­شد. برای همسانه­سازی و تراریخت­کردن از وکتور pEGM-T Easy Vector (Promega) و سلول­های مستعد E. coli سویهDH5α(نوا ژن) استفاده شد. سپس قطعات توسط آنزیم­های محدودالاثر BamHI و  XhoIاز ناقل TA کلونینگ جداسازی و در وکتور بیانی pET28a(+)(کیا­ژن) زیرهمسانه‌سازی و در سلول­های مستعد E. coli سویهBL21(DE3)(stratagen)  تراریخت و قطعه ژنی به ‌وسیلهPCR، آنزیم برشی و تعیین توالی تایید­شد(7،3).

بیان ژن موردنظر: بیان ژن مورد نظرتوسط القا­ء کننده پروموتر (IPTG)(فرمنتاز) با غلظت 1 میلی­مولار و به مدت 5 ساعت در دمای 37 درجه سانتی­گراد انجام­شد(8،3).

الکتروفورز SDS-PAGE: نمونه­های قبل و بعد از القای IPTG، همراه با مارکر پروتئینی#PR0602-S (Vivantis) تحت شرایط دناتوره، الکتروفورز شدند. غلظت ژل 15 درصد با جریان ثابت 25 میلی­آمپر بود(9).

تخلیص با ستون نیکل: پروتئین حاصل تحت شرایط دناتوره و با استفاده از ستونNi-NTA (کیا ژن) جداسازی وتخلیص شد.

تولید آنتی‌بادی علیه PA: پروتئین PA در چهار نوبت، به میزان µg20 بار اول همراه با ادجوانت کامل(رازی) و در نوبت‌های بعدی µg 15 با ادجوانت ناقص فروند به موش سوری تزریق و در نهایت از موش‌ها خون‌گیری و توسط آزمایش الایزا تیتر آنتی‌بادی آن اندازه‌گیری شد.

تأیید پروتئین نوترکیب با روش وسترن بلات: برای تأیید پروتئین نوترکیب بیان‌شده از تکنیک ایمونوبلات با آنتی­بادی پلی­کلونال ضد  PAکامل(تولیدی دانشگاه جامع امام حسین (ع))استفاده شد(10،9).

ارزیابی تیتر آنتی‌بادی ضد پروتئین نوترکیب به روش الایزای غیرمستقیم: مقدار 20 میکروگرم از پروتئین نوترکیب PA در چهار نوبت، به موش‌های سوری تزریق و درنهایت از آن‌ها خون‌گیری و توسط آزمایش الایزا غیرمستقیم تیتر آنتی‌بادی اندازه‌گیری شد(10،3).

 

یافته‌ها

تکثیر ژن PA: پس از تکثیر ژن تغییریافته PA به روش PCR، محصول روی ژل آگارز مورد ارزیابی قرار گرفت (شکل 1) و قطعه موردنظر از لحاظ اندازه با ژن هدف هم­خوانی داشت (1716 جفت باز).

تأیید همسانه­سازی ژن هدف در وکتور pEGM-T Easy Vector: پس از تخلیص پلاسمید و تأیید آن­ها روی ژل آگارز، برای تأیید بیشتر از پلاسمیدها به‌عنوان الگو در واکنش  PCRاستفاده گردید، از طرفی با دو آنزیم  BamHI و  XhoIهضم شدند سپس به کمک مار کر اسید نوکلئیک، اندازه قطعه خارج‌شده از وکتورتأیید شد(شکل 2).

تأیید همسانه­سازی ژن هدف در وکتور بیانی pET28a(+): پس از تخلیص پلاسمید و تأیید آن­ها روی ژل آگارز، برای تأیید بیشتر از پلاسمیدها به‌عنوان الگو در واکنش  PCRاستفاده گردید، از طرفی با دو آنزیم BamHI و  XhoIهضم گردیدند. سپس به کمک مار کر اسید نوکلئیک، اندازه قطعه خارج‌شده از وکتور (1716 جفت باز) تأییدگردید(شکل 3).

بیان ژن در وکتور pET28a(+): در این مرحله پس از کشت سلول­ها و القا با IPTG بیان ژن صورت پذیرفت و پس از تیمار خام بر روی ژل  SDS-PAGEو به کمک مارکر پروتئینی موردبررسی قرار گرفت. با توجه به وزن پروتئین نوترکیب (kDa 63) از ژل 15 درصد استفاده شد(شکل 4).

پس ‌از این که از القاء بیان ژن اطمینان حاصل شد، بیان با کشت کلون‌ها در محیط LB مایع حاوی μg/ml40 کانامایسین، پس از رسیدن OD محیط کشت به 6/0 درطول ‌موج 600 نانومتر، با افزودن IPTG با غلظت mM1 به محیط و انکوبه نمودن آن در دمای 37 درجه سانتی‌گراد در انکوباتور شیکر دار با سرعت rpm150 به مدت 5 ساعت به دست آمد.

تأیید محصول پروتئینی به ‌دست ‌آمده با تکنیک Western Blotting: به‌منظور تأیید محصول پروتئینی از تکنیک Western Blotting استفاده شد. در این روش از

 

شکل 1: محصول PCR از قطعات ممزوج شده. چاهک 1، 2 و 3 محصول PCR و چاهک 4 نشانگر مولکولی اسید نوکلئیک.

 

 

شکل 2: A (چاهک 1 محصول PCR وکتور pET28a(+) و چاهک 2 نشانگر مولکولی اسید نوکلئیکB) چاهک 1 نشانگر مولکولی اسید نوکلئیک و چاهک 2 محصول برش آنزیمی روی pGEM-Teasy vector

 

شکل 3: A (چاهک1نشانگر مولکولی اسید نوکلئیک چاهک 2 برش آنزیمی وکتور B pET28a(+)) چاهک 1 محصول PCR وکتور pET28a(+) چاهک 2 نشانگر مولکولی اسید نوکلئیک.

 

شکل 4: بیان پروتئین.PA چاهک 1 نمونه کنترل بدون IPTG، چاهک 2 و 3 بیان پروتئین PA دارای وزن مولکولی حدودkDa 67 با IPTG، چاهک 4 مار کر پروتئینی.

 

شکل 5: آزمایش لکه‌گذاری وسترن. چاهک 1 نمونه بیانیPA، چاهک 2 نمونه کنترل واکنش وسترن (PBS)، چاهک 3مار کر پروتئینی.

 

آنتی­بادی پلی­کلونال ضد PA کامل استفاده شد. در ستون تست که مربوط به نمونه القاشده با IPTG است یک باند در نزدیکی kDa 67 مشاهده می­شود که در ستون کنترل واکنش وسترن (PBS) مشاهده نمی­شود(شکل 5).

بررسی تولید آنتی‌بادیIgG علیه آنتی‌ژن PA در موش سوری:

روش الایزا برای تعیین تیتر آنتی‌بادی علیه پروتئین نوترکیب به‌منظور ارزیابی محصول در طول فرایند تخلیص و همچنین تعیین تیتر خنثی‌سازی در سرم حیوانات ایمن شده مورداستفاده قرار گرفت. نمودار زیر بیانگر تیتر سرم در حیوانات مورد استفاده است.

بررسی نمودار فوق، نتایج حاصل از آزمایش الایزا با پروتئین نوترکیب را نشان می‌دهد که پس از تزریق افزایش تیتر آنتی‌بادی در مقایسه با کنترل قابل‌توجه است. بالاترین  ODبه‌دست‌آمده از تست در مقایسه با کنترل تفاوت فراوانی دارد. نتایج نشان داده که این پروتئین قدرت تولید آنتی‌بادی به میزان لازم را داشته و تولید آنتی‌بادی در حیوان با ایمنی‌زایی همبستگی مثبت دارد.

بحث

برای مقابله با سیاه‌زخم سه ‌راه وجود دارد، واکسیناسیون برای پیشگیری در مرحله اول، آنتی‌بیوتیک‌ها برای درمان عفونت و درمان­های ضد سم برای جلوگیری از اثرات سمی باکتری در اواخر مرحله عفونت(11). تنها اجزا پروتئین­های سمی باسیلوس آنتراسیس دارای خاصیت آنتی ژنیک بسیار قوی بوده که زیر واحد  PAبه‌ عنوان کاندید اصلی واکسن این عامل مطرح هست و ایمنی حمایتی، علیه بیماری ایجاد می‌کنند. این ایمنی درنتیجه خنثی­سازی فعالیت توکسین آنتراکس اتفاق می­افتد (12،6). PA یک جزء بسیار مهم از توکسین آنتراکس است. این پروتئین در ایمنی علیه آنتراکس نقش اصلی را هم بعد از ایمن­سازی و هم در جریان عفونت بازی می­کند و دارای خاصیت مهار­کنندگی برای فاکتور­های بیماری‌زایLF و EF هست(6،3). با توجه به نقش آن، PA به‌طور گسترده­ای به‌ عنوان یکی از کاندیدهای واکسن مورد مطالعه قرارگرفته است(14،13،12). برای مطالعه خصوصیات یک آنتی‌ژن به‌عنوان واکسن ضرورت دارد که پروتئین نوترکیب در یکی از میزبان‌ها تولید شود. یکی از میزبان‌های کم‌هزینه برای تولید پروتئین‌های نوترکیب باکتری اکولای هست که در آزمایشگاه مرکز زیست‌شناسی دانشگاه جامع امام حسین(ع) از این میزبان به‌وفور استفاده می‌شود. نتایج به‌ دست‌آمده نشان می‌دهد که این ژن در وکتور PET28 بیان بسیار بالایی را از خود نشان داده است. آنتی‌ژن PA تغییریافته به ‌عنوان دارو برای باسیلوس آنتراسیس مطرح بوده که پروتئین نوترکیب آن در میزبان اکولای با موفقیت تولیدشده است.

 

 

نمودار 1: بررسی تیتر آنتی‌بادی ‏IgG‏ تولیدشده درموش سوری علیه آنتی‎ژن ‏63PA‏ بر پایه اجوانت فروند

 

پاسخ آنتی­بادی به تولید درون‌سلولیPA ,LF ,EF در موش­های ایمن شده با اسپورهایی از سویه­های تولیدکننده این پروتئین­ها مورد بررسی قرار گرفت و بالاترین تیترآنتی‌بادی به PA، بعدازاینکه ایمن­سازی با همه ‌سویه‌های تولیدکننده   PA انجام‌شده، مشاهده شد(15). در مطالعه‌ای دیگر ایمنی‌زایی دو من 4-2 و دومن‌های دیگر PA در 4 سویه متفاوت موش بررسی گردید. ژن بیان‌شده خاصیت ایمونوژنیسیته و ادجوانتی خوبی را نشان داد(7). همه این شواهد،PA  را به‌عنوان یک ایمونودومیننت غالب شناسایی می­کند که می­تواند در طراحی یک واکسن مهندسی ‌شده استفاده شود(3). همچنین نتایج به‌دست‌آمده در پژوهش ما نتایج بالا را تأیید می‌کند و تیتر آنتی‌بادی تولیدی در موش که در قسمت نتایج نشان داده‌شده است بیانگر این موضوع هست. آنتی‌بادی‌های علیه  PAمی‌توانند تأثیر توکسین آنتراکس بر روی میزبان را متوقف کنند(12،6،3). با تغییر آنتی‌ژن محافظت‌کننده (PA) کامل و فاقد 20 کیلو دالتونی با یک و یا دو اسیدآمینه تغییریافته در نواحی 427یا 396 و 425 دارای خاصیت مهارکنندگی برای فاکتورهای بیماری‌زایLF و EF بوده که ساختار هپتامری تشکیل‌شده ولی عمل انتقال به داخل سلول صورت نخواهد گرفت. این پروتئین دارای خاصیت درمانی و ایمنی‌زایی است که ازنظر تهیه دارو و واکسن بسیار مهم خواهد بود(16،6،3).‍‍‍‍

موتاسیون هایی که عملکرد انتقال PA را مهار می‌کنند یا از طریق اختلال در انتقال توکسین و یا در باز آرایی کانفورماسیونی دومن دو برای تشکیل منفذ، اثرگذار هستند. دو کلاس از این موتاسیونها در دومن دوطبقه بندی شده‌اند: آن‌هایی که تبدیل پیش منفذ به منفذ را بلوکه می­کنند و آن‌هایی که اجازه تشکیل منفذ را می‌دهند ولی توانایی منفذ در ترانسلوکاسیون را از بین می‌برند(8). از این ویژگی می‌توان به‌عنوان دارو برای به دام اندازی سم باکتری سیاه‌زخم استفاده کرد. با توجه به نتایج پژوهش مااین عملکرد در پژوهش‌های آینده می‌تواند موردبررسی قرار گیرد. اسیدآمینه 427 PA که فنیل آلانین است نقش زیادی در انتقال PA دارد، زیرا هم برای تشکیل منفذ و انتقال پروتئین مهم است. از طرفی ثابت‌شده است برخی از موتاسیون های اسیدآمینه 427 در داخل بدن دارای فعالیت‌های درمانی می‌باشند(17).

در موش موتاسیون فنیل آلانین موقعیت 427 به آسپارتیک اسید اثرات مهاری قوی‌تری از موتاسیون فنیل آلانین به آسپارژین نشان می‌دهد؛ بنابراین، می‌توان از پتانسیل درمانیPA  موتاسیون یافته برای درمان آنتراکس درصورتی‌که زود و قبل از ورود باکتری به بدن و یا در مراحل اولیه عفونت که تعداد باکتری کم است و ترشح سم به میزان کم است تزریق شود. در این حالت می‌توان از PA موتاسیون یافته به‌عنوان دارو برای درمان استفاده کرد(18). از آنجایی‌که ارتباط مثبتی بین موتاسیون اسیدآمینه فنیل آلانین 427 بر روی سمیت سلولی وجود دارد. این اثر درنتیجه ایجاد اختلال در تشکیل منفذ و فرایند عبور از غشا رخ می‌دهد (20،19). موتاسیون یافته‌هایF427W،  F427L وF427Y در واسطه‌گری در سمیت سلولی بسیار فعال هستند و موجب انتقال مؤثر در سرتاسر غشا به داخل سیتوزول سلول‌های مدل می‌شود. موتاسیون یافته‌هایF427G ، F427R و F427D باعث اختلال در تشکیل منفذ می‌شوند که این اثر با توجه به توانایی‌شان متفاوت است(18). در مثال­های زیر تأثیر انواع موتاسیون یافته­های اسید­آمینه فنیل آلانین 427 در سمیت سلولی و درصد تشکیل منفذ مشخص‌شده است. در مورد موتاسیون یافته‌های F427S، F427T و F427H تشکیل منفذ 100 درصد می­باشد و سمیت سلولی مشاهده نشده، در حالت F427D تشکیل منفذ 25 در صد است و سمیت سلولی نیز ایجاد نمی‌شود و اما در مورد موتاسیون یافته F427G که مورد توجه و استفاده در این پژوهش نیز است منفذی تشکیل نمی‌شود و سمیت سلولی نیز ایجاد نمی‌شود(19).

تغییریافتگی اسیدآمینه 427 ژن PA به گلایسین باعث می‌شود که عمل انتقال صورت نگیرد و حبس EF یا LF در داخل هپتامر یا اکتامر انجام گیرد. از این ویژگی می‌توان برای ساخت یک دارو علیه سیاه‌زخم استفاده کرد(20،19). بر اساس نتایج این پژوهش نقش آنتی‌ژن حفاظتی تغییریافته PA63 در ایجاد آنتی‌بادی علیه آن به اثبات رسید. با توجه به نتایج به‌دست‌آمده از این تحقیق و بررسی مطالعات انجام‌شده این پروتئین را می‌توان به‌عنوان یک ایمونوژن برای طراحی یک واکسن و داروی مهندسی‌شده نوترکیب پیشنهاد نمود.

 

تشکر و قدردانی

در پایان از زحمات اساتید، پژوهشگران محترم مرکز و گروه علوم زیستی، دانشگاه جامع امام حسین(ع) تهران که در به نتیجه رسیدن این پژوهش ما را حمایت معنوی و مالی نمودند سپاسگزاری می‌شود.

 

References

  1. Ahmadi AH, Honari H, EbrahimMinaei M. Cloning, fusion and expression of domain a-1 protective antigen (PA20) of Bacillus anthracis and N-Terminal ipaD gene of Shigella in E. coli. Qom Univ Med Sci 2015; 9(4): 20-29. (Persian)
  2. Koehler TM. Bacillus anthracis physiology and genetics. Mol Aspects Med. 2009; 30(6): 386-396.
  3. Honari H, Mehrazin H, Saadati M, Minaie ME. Production of polycolonal antibody against domain 2-4 of protective antigen of Bacillus anthracis in laboratory animal. J ShahrekordUni Med Sci 2014; 15(6): 35-43. (Persian)
  4. Bragg TS, Robertson DL. Nucleotide sequence and analysis of the lethal factor gene (lef) from Bacillus anthracis. Gene. 1989; 81(1): 45-54.
  5. Benson E, Huynh P, Finklestein A, Collier R. Identification of residues lining the anthrax protective antigen channel. Biochemistry. 1998; 37(11): 3941-8.
  6. Turnbull Panthrax vaccines: past, present and future. Vaccine. 1991; 9: 533-539.
  7. Abboud N, Casadevall A. Immunogenicity of Bacillus anthracis Protective Antigen Domains and Efficacy of Elicited Antibody Responses Depend on Host Genetic Background. Clinical and vaccine immunology, 2008; p: 1115–1123.
  8. P13423(PAG_BACAN), Reviewed, UniProtKB/Swiss-Prot. [Last modified October 5, 2010; Version 109].
  9. Honari H, Baranvand M, EbrahimMinaei M. Immunogenicity Investigation of recombinant proteins (StxB) of Shigelladysenteriae type 1 in mice. Quarterly J of SabzevarUni of Med Sci. 2015; 21(6):1111. (Persian)
  10. Little SF, Webster WM, Norris SLW, Andrews GP. Evaluation of an anti-rPAIgG ELISA for measuring the antibody response in mice. Biologicals. 2004; 32(2): 62-9.
  11. Friedlander A. M. Tackling anthrax. Nature. 2001; 414:160–161.
  12. Singh, Y. B. E. Ivins, and S. H. Leppla. Study of immunization against anthrax with the purified recombinant protective antigen of Bacillus anthracis. Infect Immun. 1998; 66:3447–3448.
  13. Grabenstein J D. Vaccines: countering antrax: vaccines and immunoglobulins. Clin Infect Dis. 2008; 46:129–136.
  14. Sloat, B. R. and Z. Cui. Nasal immunization with anthrax protective antigen protein adjuvanted with polyriboinosinic-polyribocytidylic acid induced strong mucosal and systemic immunities. Pharm Res. 2006; 23:1217–1226.
  15. Pezard C, Sirard JC and Mock M. Protective immunity induced by Bacillus anthracis toxin mutant strains. AdvExp Med Biol. 1996; 397: 69–72.
  16. Ivins B,Welkos S.Recent advances in the development of an improved human anthrax vaccine. Eur J Epidemiol. 1988; 4(1): 12-9.
  17. Mourez, M. M. Yan, D. B. Lacy, L. Dillon, L. Bentsen, A. Marpoe, C. Maurin, E. Hotze, D. Wigelsworth, R. A. Pimental, J. D. Ballard, R. J. Collier, and R. K. Tweten. Mapping dominant-negative mutations of anthrax protective antigen by scanning mutagenesis. ProcNatlAcadSci USA. 2003; 100:13803–13808.
  18. Yan M, Roehrl M H, Basar E, Wang J Y. Selection and evaluation of the immunogenicity of protective antigen mutants as anthrax vaccine candidates. Vaccine. 2008; 26: 947–955.
  19. Sun J, E Lang A, Aktories K, Collier R J. Phenylalanine-427 of anthrax protective antigen functions in both pore formation and protein translocation. 2008; 105(11): 4346-4351.
  20. Cao S, Guo A, Liu Z, Tan Y, Wu G, Zhang Ch, Zhao Y, Chen H. Investigation of New Dominant-Negative Inhibitors of Anthrax Protective Antigen Mutants for Use in Therapy and Vaccination. American Society for Microbiology. 2009; 77(10): 4679–4687.

 

 


 

 

Original Article

Cloning and Recombinant Expression modified protective antigen from Bacillus anthracis In E. coil

 

Seyed Masih E'temad Aubi

PhD Student of nanobiotechnology, Department of Biology, Biology Research Center, Imam Hosein University, Tehran

 

*Hossein Honari

PhD in molecular genetics,  Department of Biology, Biology Research Center, Imam Hosein University, Tehran

 

Received:03/11/2015, Revised:23/12/2015, Accepted:31/01/2016


Abstract

Background: Anthrax is a common illness between human and animal which the agent of that is Bacillus anthracis. The modified protective antigen cab be used in treatment and vaccination. The aim of this study is the recombinant expression of modified protective antigen in E. coli.

Material and Methods: Gene fragments were amplified with PCR from pXOI and fusion gene from SOEing PCR was cloned in a cloning vector and finally sub cloned in pET28a(+) vector and transferred to E. coli BL21(DE3) competent cells. Recombinant expression of modified PA was induced by IPTG and after protein purification with affinity chromatography, resulted antigen was injected to mice in 4 repeats. Polyclonal antibodies produced in mice serum was accessed.

Results: The modified protective antigen cloned in expression vector pET28a(+) was confirmed by PCR, enzymatic digestion and sequencing. Recombinant protein was confirmed by SDS-PAGE and western blot. Serum was separated from mice blood and titre of antibody against modified PA was assessed by indirect ELYSA.

Conclusion: resulted protein has high inhibitory property for LF and EF virulence factors. By consideration in PA detection by polyclonal antibody against modified PA from Bacillus anthracis, it can be used in for treatment and prophylaxis against anthrax in individual or combination forms with other PA domains.

Keywords: protective antigen, Bacillus anthracis, recombinant protein

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Corresponding author:

Hossein honari,

Imam Hosein University, Tehran

E-mail: honari.hosein@gmail.com

  1. Ahmadi AH, Honari H, EbrahimMinaei M. Cloning, fusion and expression of domain a-1 protective antigen (PA20) of Bacillus anthracis and N-Terminal ipaD gene of Shigella in E. coli. Qom Univ Med Sci 2015; 9(4): 20-29. (Persian)
  2. Koehler TM. Bacillus anthracis physiology and genetics. Mol Aspects Med. 2009; 30(6): 386-396.
  3. Honari H, Mehrazin H, Saadati M, Minaie ME. Production of polycolonal antibody against domain 2-4 of protective antigen of Bacillus anthracis in laboratory animal. J ShahrekordUni Med Sci 2014; 15(6): 35-43. (Persian)
  4. Bragg TS, Robertson DL. Nucleotide sequence and analysis of the lethal factor gene (lef) from Bacillus anthracis. Gene. 1989; 81(1): 45-54.
  5. Benson E, Huynh P, Finklestein A, Collier R. Identification of residues lining the anthrax protective antigen channel. Biochemistry. 1998; 37(11): 3941-8.
  6. Turnbull Panthrax vaccines: past, present and future. Vaccine. 1991; 9: 533-539.
  7. Abboud N, Casadevall A. Immunogenicity of Bacillus anthracis Protective Antigen Domains and Efficacy of Elicited Antibody Responses Depend on Host Genetic Background. Clinical and vaccine immunology, 2008; p: 1115–1123.
  8. P13423(PAG_BACAN), Reviewed, UniProtKB/Swiss-Prot. [Last modified October 5, 2010; Version 109].
  9. Honari H, Baranvand M, EbrahimMinaei M. Immunogenicity Investigation of recombinant proteins (StxB) of Shigelladysenteriae type 1 in mice. Quarterly J of SabzevarUni of Med Sci. 2015; 21(6):1111. (Persian)
  10. Little SF, Webster WM, Norris SLW, Andrews GP. Evaluation of an anti-rPAIgG ELISA for measuring the antibody response in mice. Biologicals. 2004; 32(2): 62-9.
  11. Friedlander A. M. Tackling anthrax. Nature. 2001; 414:160–161.
  12. Singh, Y. B. E. Ivins, and S. H. Leppla. Study of immunization against anthrax with the purified recombinant protective antigen of Bacillus anthracis. Infect Immun. 1998; 66:3447–3448.
  13. Grabenstein J D. Vaccines: countering antrax: vaccines and immunoglobulins. Clin Infect Dis. 2008; 46:129–136.
  14. Sloat, B. R. and Z. Cui. Nasal immunization with anthrax protective antigen protein adjuvanted with polyriboinosinic-polyribocytidylic acid induced strong mucosal and systemic immunities. Pharm Res. 2006; 23:1217–1226.
  15. Pezard C, Sirard JC and Mock M. Protective immunity induced by Bacillus anthracis toxin mutant strains. AdvExp Med Biol. 1996; 397: 69–72.
  16. Ivins B,Welkos S.Recent advances in the development of an improved human anthrax vaccine. Eur J Epidemiol. 1988; 4(1): 12-9.
  17. Mourez, M. M. Yan, D. B. Lacy, L. Dillon, L. Bentsen, A. Marpoe, C. Maurin, E. Hotze, D. Wigelsworth, R. A. Pimental, J. D. Ballard, R. J. Collier, and R. K. Tweten. Mapping dominant-negative mutations of anthrax protective antigen by scanning mutagenesis. ProcNatlAcadSci USA. 2003; 100:13803–13808.
  18. Yan M, Roehrl M H, Basar E, Wang J Y. Selection and evaluation of the immunogenicity of protective antigen mutants as anthrax vaccine candidates. Vaccine. 2008; 26: 947–955.
  19. Sun J, E Lang A, Aktories K, Collier R J. Phenylalanine-427 of anthrax protective antigen functions in both pore formation and protein translocation. 2008; 105(11): 4346-4351.
  20. Cao S, Guo A, Liu Z, Tan Y, Wu G, Zhang Ch, Zhao Y, Chen H. Investigation of New Dominant-Negative Inhibitors of Anthrax Protective Antigen Mutants for Use in Therapy and Vaccination. American Society for Microbiology. 2009; 77(10): 4679–4687.